Xanthomonas citri pv. citri MN12: J164_03568 Help Entry J164_03568        CDS       T03735                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism xcm  Xanthomonas citri pv. citri MN12 Brite KEGG Orthology (KO) [BR:xcm00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:xcm03036]     J164_03568 Chromosome and associated proteins [BR:xcm03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     J164_03568 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Herpes_BLRF2 bZIP_1 Taxilin YabA FAZ1_C Dynamitin SKA2 Stathmin DUF7491 APG6_N Glutaredoxin2_C DUF3450 bZIP_2 DUF7603 DivIC DUF2203 Motif Other DBs NCBI-ProteinID:  AJY96830 UniProt:  A0A0U5FI03 LinkDB All DBs Position 3991279..3991500 Genome browser AA seq 73 aa AA seqDB search MDNAAALAQIRALAARVEALVERTQRLTDENRSLRHQQEQLIGERSQLLTKNEQARSRVE AMIARLKSLEQHT NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggacaacgctgccgccctcgctcagatccgcgcactcgccgcccgcgtggaggcgttg gtggagcgtacccaacggctcaccgacgagaatcgcagcttgcgtcatcaacaggagcaa ctcatcggcgagcgctcgcaactgttgaccaagaacgagcaggcgcgctcgcgggtggaa gcgatgatcgcccgcctgaagtcattggagcagcacacgtga

DBGET integrated database retrieval system