Xanthomonas campestris pv. raphani: XCR_3602 Help Entry XCR_3602          CDS       T01872                                  Name (GenBank) conserved hypothetical protein   KO K09892   cell division protein ZapB Organism xcp  Xanthomonas campestris pv. raphani Brite KEGG Orthology (KO) [BR:xcp00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:xcp03036]     XCR_3602 Chromosome and associated proteins [BR:xcp03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     XCR_3602 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Herpes_BLRF2 bZIP_1 Taxilin YabA Stathmin FAZ1_C SKA2 bZIP_2 APG6_N DUF7603 Motif Other DBs NCBI-ProteinID:  AEL08463 LinkDB All DBs Position 3839557..3839778 Genome browser AA seq 73 aa AA seqDB search MDNAAALAQLRALAARVEALVERTQRLTDENRSLRHQQEQLIGERAQLLTKNEQARSRVE AMIVRLKSLEQHT NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggacaacgccgccgccctcgcccagctccgcgcactcgccgcccgtgtggaggcgttg gtggagcgcacccagcggctcaccgacgaaaaccgcagcctgcgccaccaacaggaacag ttgatcggcgagcgcgcgcagctgctgaccaagaacgaacaggcacgctcgcgcgtggaa gccatgatcgtgcgattgaagtcactggagcagcacacgtga

DBGET integrated database retrieval system