Xanthomonas citri pv. citri MN11: J163_00659 Help Entry J163_00659        CDS       T03780                                  Name (GenBank) Co-chaperonin GroES (HSP10)   KO K04078   chaperonin GroES Organism xcr  Xanthomonas citri pv. citri MN11 Brite KEGG Orthology (KO) [BR:xcr00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03110 Chaperones and folding catalysts [BR:xcr03110]     J163_00659    03029 Mitochondrial biogenesis [BR:xcr03029]     J163_00659 Chaperones and folding catalysts [BR:xcr03110]  Heat shock proteins   HSP10    J163_00659 Mitochondrial biogenesis [BR:xcr03029]  Mitochondrial protein import machinery   Matrix    Other matrix factors     J163_00659 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Cpn10 RnfC_N Motif Other DBs NCBI-ProteinID:  AJY98406 UniProt:  A0A0U5F7F1 LinkDB All DBs Position 632274..632561 Genome browser AA seq 95 aa AA seqDB search MSIKPLHDRVVVKPIEADEVSAGGIVIPDSAKEKSTKGEVVAIGAGKPLDNGSLRAPVVK VGDKVIYGQYAGSSYKSEGVEYKVLREDDILAVIG NT seq 288 nt NT seq  +upstreamnt  +downstreamnt atgagcatcaagccgcttcacgaccgcgttgtagtcaagccgatcgaagccgacgaagtt tccgccggcggcatcgtgattccggactccgccaaggaaaagtccaccaagggtgaagtc gtcgcgatcggcgccggcaagccgctggacaacggcagcctgcgcgcgccggtggtcaag gttggcgacaaggtcatctacggccagtacgccggcagcagctacaagtccgaaggcgtc gagtacaaggtgctgcgcgaagacgacatcctggccgtcatcggctga

DBGET integrated database retrieval system