Xanthomonas dyei: NYR95_17920 Help Entry NYR95_17920       CDS       T09460                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism xdy  Xanthomonas dyei Brite KEGG Orthology (KO) [BR:xdy00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:xdy03036]     NYR95_17920 Chromosome and associated proteins [BR:xdy03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     NYR95_17920 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Herpes_BLRF2 bZIP_1 Taxilin YabA FAZ1_C SKA2 Stathmin APG6_N bZIP_2 DUF7603 Motif Other DBs NCBI-ProteinID:  WOB56297 LinkDB All DBs Position 4123219..4123440 Genome browser AA seq 73 aa AA seqDB search MDNAAALAQLRALAARVEALVERTQRLTDENRSLRHQQEQLIGERSQLLTKNEQARSRVE AMIVRLKSLEQHT NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggacaacgctgccgccctcgcccaactccgcgcacttgccgcccgcgtggaagcgctg gtcgagcggactcaacggctgaccgacgaaaaccgcagcctgcggcatcaacaggaacag ttgatcggcgagcgttcgcaactgctgaccaagaacgagcaggcgcgctcgcgggtggaa gcgatgatcgtgcggttgaagtcattggagcagcacacgtga

DBGET integrated database retrieval system