Xenopus laevis (African clawed frog): 394349 Help Entry 394349            CDS       T01010                                  Symbol mt4.L, MT, mt-A, mt1, mt4, mtiv Name (RefSeq) metallothionein   KO K14739   metallothionein 1/2 Organism xla  Xenopus laevis (African clawed frog) Brite KEGG Orthology (KO) [BR:xla00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:xla03019]     394349 (mt4.L)    03029 Mitochondrial biogenesis [BR:xla03029]     394349 (mt4.L) Messenger RNA biogenesis [BR:xla03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      394349 (mt4.L) Mitochondrial biogenesis [BR:xla03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     394349 (mt4.L) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  394349 NCBI-ProteinID:  NP_001081042 Xenbase:  XB-GENE-6254442 UniProt:  Q05890 LinkDB All DBs Position 4L:complement(44000474..44002964) Genome browser AA seq 62 aa AA seqDB search MDPQDCKCETGASCSCGTTCSCSNCKCTSCKKSCCSCCPAECSKCSQGCHCEKGSKKCSC CN NT seq 189 nt NT seq  +upstreamnt  +downstreamnt atggaccctcaggactgcaaatgcgaaacaggtgcttcctgctcctgtggtactacctgc agttgcagcaattgcaagtgcacatcatgcaagaaaagctgctgttcctgctgtccagct gaatgcagcaaatgcagccagggctgccactgtgaaaagggaagcaagaagtgcagctgc tgtaactga

DBGET integrated database retrieval system