Xanthomonas oryzae pv. oryzae PXO99A: PXO_03704 Help Entry PXO_03704         CDS       T00763                                  Symbol groS Name (GenBank) chaperonin GroS   KO K04078   chaperonin GroES Organism xop  Xanthomonas oryzae pv. oryzae PXO99A Brite KEGG Orthology (KO) [BR:xop00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03110 Chaperones and folding catalysts [BR:xop03110]     PXO_03704 (groS)    03029 Mitochondrial biogenesis [BR:xop03029]     PXO_03704 (groS) Chaperones and folding catalysts [BR:xop03110]  Heat shock proteins   HSP10    PXO_03704 (groS) Mitochondrial biogenesis [BR:xop03029]  Mitochondrial protein import machinery   Matrix    Other matrix factors     PXO_03704 (groS) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Cpn10 RnfC_N Motif Other DBs NCBI-ProteinID:  ACD57161 UniProt:  B2SJG3 LinkDB All DBs Position 523794..524081 Genome browser AA seq 95 aa AA seqDB search MSIKPLHDRVVVKPIEADEVSAGGIVIPDSAKEKSTKGEVVAIGAGKPLDNGSLRAPVVK VGDKVIYGQYAGSSYKSEGVEYKVLREDDILAVIG NT seq 288 nt NT seq  +upstreamnt  +downstreamnt atgagcatcaagccgcttcacgaccgcgttgtagtcaagccgatcgaagccgacgaagtt tccgccggcggcatcgtgatcccggactccgccaaggaaaagtccaccaagggtgaagtc gtcgccatcggcgccggcaagccgctggacaacggcagcctgcgcgcgccggtggtcaag gtgggcgacaaggtcatctacggccagtacgccggcagcagctacaagtccgaaggcgtc gagtacaaggtgttgcgcgaagacgacatcctggccgtcatcggctga

DBGET integrated database retrieval system