Xanthomonas oryzae pv. oryzicola BLS256: XOC_0615 Help Entry XOC_0615          CDS       T01873                                  Symbol groS Name (GenBank) chaperonin GroS   KO K04078   chaperonin GroES Organism xor  Xanthomonas oryzae pv. oryzicola BLS256 Brite KEGG Orthology (KO) [BR:xor00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03110 Chaperones and folding catalysts [BR:xor03110]     XOC_0615 (groS)    03029 Mitochondrial biogenesis [BR:xor03029]     XOC_0615 (groS) Chaperones and folding catalysts [BR:xor03110]  Heat shock proteins   HSP10    XOC_0615 (groS) Mitochondrial biogenesis [BR:xor03029]  Mitochondrial protein import machinery   Matrix    Other matrix factors     XOC_0615 (groS) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Cpn10 RnfC_N DUF7205 Motif Other DBs NCBI-ProteinID:  AEQ94824 UniProt:  G7TBE4 LinkDB All DBs Position 609264..609551 Genome browser AA seq 95 aa AA seqDB search MSIKPLHDRVVVKPIEADEVSAGGIVIPDSAKEKSTKGEVVAIGTGKPLDNGSLRAPVVK VGDKVIYGQYAGSSYKSEGVEYKVLREDDILAVIG NT seq 288 nt NT seq  +upstreamnt  +downstreamnt atgagcatcaagccgcttcacgaccgcgttgtagtcaagccgatcgaagccgacgaagtt tccgccggcggcatcgtgatcccggactccgccaaggaaaagtccaccaagggtgaagtc gtcgccatcggcaccggcaagccgctggacaacggcagcctgcgcgcgccggtggtcaag gtgggcgacaaggtcatctacggccagtacgccggcagcagctacaagtccgaaggcgtc gagtacaaggtgctgcgcgaagacgacatcctggccgtcatcggctga

DBGET integrated database retrieval system