Xylella taiwanensis: AB672_05170 Help Entry AB672_05170       CDS       T05568                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism xtw  Xylella taiwanensis Brite KEGG Orthology (KO) [BR:xtw00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:xtw03036]     AB672_05170 Chromosome and associated proteins [BR:xtw03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     AB672_05170 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB FAZ1_C Taxilin Plant_NMP1 YabA Stathmin DUF7491 NRBF2 Motif Other DBs NCBI-ProteinID:  AXI83371 UniProt:  Z9JMB6 LinkDB All DBs Position complement(1228795..1229016) Genome browser AA seq 73 aa AA seqDB search MDQTDALTQLHALATHVERLIESYKRLADENRNLRYQQDQMIVERSQLLAKNEQARSRVE AMITRLKALEQHT NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggatcagactgacgccctcacccaactccacgccctggccacacacgtggagaggttg atcgagtcctacaaacgtttagccgacgagaaccgcaacttgcgctatcagcaggatcaa atgattgtggaacgctctcagcttctggccaaaaacgaacaagcgcgctcccgcgtggaa gcaatgattacacgtcttaaggccctggagcagcacacgtga

DBGET integrated database retrieval system