Xylophilus sp. GOD-11R: R9X41_05085 Help Entry R9X41_05085       CDS       T09600                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism xyg  Xylophilus sp. GOD-11R Brite KEGG Orthology (KO) [BR:xyg00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:xyg03032]     R9X41_05085    03036 Chromosome and associated proteins [BR:xyg03036]     R9X41_05085    03400 DNA repair and recombination proteins [BR:xyg03400]     R9X41_05085 DNA replication proteins [BR:xyg03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     R9X41_05085 Chromosome and associated proteins [BR:xyg03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     R9X41_05085 DNA repair and recombination proteins [BR:xyg03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       R9X41_05085 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 UBA_HYPK HU-CCDC81_euk_2 Motif Other DBs NCBI-ProteinID:  WPB58020 LinkDB All DBs Position 1109877..1110149 Genome browser AA seq 90 aa AA seqDB search MNKTELIEHIAKNADISKAAATRALESTIGAVKTTLKKGGTVSLVGFGTFAVGKRAARSG RNPRTGAAIKIKAAKVPKFRPGKALKDALN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt gtgaacaagaccgaactgatcgagcacatcgccaagaacgccgacatttccaaggcagcc gctacccgcgcgctggaatccaccatcggcgccgtcaagaccacattgaagaaaggcggc acggtctcgctcgtcggtttcggaaccttcgccgttggcaagcgtgcagcccgcagcggc cgtaatccgcgcactggtgccgcgatcaagatcaaggctgctaaagtaccgaagttccgt ccgggcaaggccctgaaggatgccctgaattga

DBGET integrated database retrieval system