KEGG   Homo sapiens (human): 406902Help
Entry
406902            miRNA     T01001                                 

Gene name
MIR10A, MIRN10A, hsa-mir-10a, miRNA10A, mir-10a
Definition
(RefSeq) microRNA 10a
  KO
K16864  microRNA 10a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05205  Proteoglycans in cancer
hsa05206  MicroRNAs in cancer
hsa05418  Fluid shear stress and atherosclerosis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406902 (MIR10A)
   05205 Proteoglycans in cancer
    406902 (MIR10A)
  09166 Cardiovascular disease
   05418 Fluid shear stress and atherosclerosis
    406902 (MIR10A)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406902 (MIR10A)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406902 (MIR10A)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406902
OMIM: 610173
HGNC: 31497
Ensembl: ENSG00000284038
miRBase: MI0000266
LinkDB All DBs
Position
17q21.32
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
taccctgtagatccgaatttgtg

DBGET integrated database retrieval system