KEGG   Homo sapiens (human): 406906Help
Entry
406906            miRNA     T01001                                 

Gene name
MIR122, MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, mir-122
Definition
(RefSeq) microRNA 122
  KO
K17020  microRNA 122
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406906 (MIR122)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406906 (MIR122)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406906 (MIR122)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of hepatic cells
   406906 (MIR122)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406906 (MIR122)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406906
OMIM: 609582
HGNC: 31501
Ensembl: ENSG00000284440
miRBase: MI0000442
LinkDB All DBs
Position
18q21.31
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
tggagtgtgacaatggtgtttg

DBGET integrated database retrieval system