KEGG   Homo sapiens (human): 406933Help
Entry
406933            miRNA     T01001                                 

Gene name
MIR141, MIRN141, mir-141
Definition
(RefSeq) microRNA 141
  KO
K17018  microRNA 141
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406933 (MIR141)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406933 (MIR141)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406933 (MIR141)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of ovarian cancer cells
   406933 (MIR141)
  Exosomal RNA of renal carcinoma cells
   406933 (MIR141)
  Exosomal RNA of other cancer cells
   406933 (MIR141)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406933 (MIR141)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406933
OMIM: 612093
HGNC: 31528
Ensembl: ENSG00000207708
miRBase: MI0000457
LinkDB All DBs
Position
12p13.31
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
catcttccagtacagtgttgga

DBGET integrated database retrieval system