KEGG   Homo sapiens (human): 406953Help
Entry
406953            miRNA     T01001                                 

Gene name
MIR18A, C13orf25, MIR17HG, MIR18, MIRH1, MIRHG1, MIRN18, MIRN18A, hsa-mir-18, hsa-mir-18a, miR-18, miRNA18A, mir-18a
Definition
(RefSeq) microRNA 18a
  KO
K17003  microRNA 18a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406953 (MIR18A)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406953 (MIR18A)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406953 (MIR18A)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of ovarian cancer cells
   406953 (MIR18A)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406953 (MIR18A)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406953
OMIM: 609417
HGNC: 31548
Ensembl: ENSG00000283815
miRBase: MI0000072
LinkDB All DBs
Position
13q31.3
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
taaggtgcatctagtgcagatag

DBGET integrated database retrieval system