KEGG   Homo sapiens (human): 406997Help
Entry
406997            miRNA     T01001                                 

Gene name
MIR215, MIRN215, miRNA215, mir-215
Definition
(RefSeq) microRNA 215
  KO
K17167  microRNA 215
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406997 (MIR215)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406997 (MIR215)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406997 (MIR215)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of hepatic cancer cells
   406997 (MIR215)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406997 (MIR215)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406997
OMIM: 610943
HGNC: 31592
Ensembl: ENSG00000207590
miRBase: MI0000291
LinkDB All DBs
Position
1q41
NT seq 21 nt NT seq  +upstreamnt  +downstreamnt
atgacctatgaattgacagac

DBGET integrated database retrieval system