KEGG   Homo sapiens (human): 442918Help
Entry
442918            miRNA     T01001                                 

Gene name
MIR373, MIRN373, hsa-mir-373, miRNA373, mir-373
Definition
(RefSeq) microRNA 373
  KO
K17000  microRNA 373
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    442918 (MIR373)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    442918 (MIR373)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    442918 (MIR373)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of ovarian cancer cells
   442918 (MIR373)
  Exosomal RNA of hepatic cancer cells
   442918 (MIR373)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   442918 (MIR373)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 442918
OMIM: 611954
HGNC: 31787
Ensembl: ENSG00000199143
miRBase: MI0000781
LinkDB All DBs
Position
19q13.42
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
actcaaaatgggggcgctttcc

DBGET integrated database retrieval system