Pan troglodytes (chimpanzee): 751938 Help Entry 751938            miRNA     T01005                                  Symbol MIR92-1 Name (RefSeq) ptr-miR-92   KO K17008   microRNA 92a Organism ptr  Pan troglodytes (chimpanzee) Pathway ptr05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:ptr00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     751938 (MIR92-1)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ptr04147]     751938 (MIR92-1)   09184 RNA family    03100 Non-coding RNAs [BR:ptr03100]     751938 (MIR92-1) Exosome [BR:ptr04147]  Exosomal RNA   Exosomal RNA of breast milk    751938 (MIR92-1)   Exosomal RNA of colorectal cancer cells    751938 (MIR92-1)   Exosomal RNA of renal carcinoma cells    751938 (MIR92-1)   Exosomal RNA of other cancer cells    751938 (MIR92-1) Non-coding RNAs [BR:ptr03100]  Small non-coding RNA   Micro RNA    751938 (MIR92-1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  751938 Ensembl:  ENSPTRG00000027605 miRBase:  MI0003000 LinkDB All DBs Position 13:72599789..72599866 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tattgcacttgtcccggcctgt

DBGET integrated database retrieval system