Apis mellifera (honey bee): 100315656 Help Entry 100315656         miRNA     T01057                                  Symbol Mirlet7 Name (RefSeq) ame-let-7   KO K16980   microRNA let-7 Organism ame  Apis mellifera (honey bee) Brite KEGG Orthology (KO) [BR:ame00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ame04147]     100315656 (Mirlet7)   09184 RNA family    03100 Non-coding RNAs [BR:ame03100]     100315656 (Mirlet7) Exosome [BR:ame04147]  Exosomal RNA   Exosomal RNA of breast milk    100315656 (Mirlet7)   Exosomal RNA of saliva    100315656 (Mirlet7)   Exosomal RNA of ovarian cancer cells    100315656 (Mirlet7)   Exosomal RNA of renal carcinoma cells    100315656 (Mirlet7)   Exosomal RNA of other cancer cells    100315656 (Mirlet7) Non-coding RNAs [BR:ame03100]  Other eukaryotic RNA   Micro RNA    100315656 (Mirlet7) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315656 miRBase:  MI0005726 LinkDB All DBs Position LG8:complement(7660424..7660523) Genome browser NT seq 21 nt NT seq  +upstreamnt  +downstreamnt tgaggtagtaggttgtatagt

DBGET integrated database retrieval system