Cyprinus carpio (common carp): 122143439
Help
Entry
122143439 ncRNA
T05134
Name
(RefSeq) U5 spliceosomal RNA
KO
K14279
U5 spliceosomal RNA
Organism
ccar
Cyprinus carpio (common carp)
Pathway
ccar03040
Spliceosome
Brite
KEGG Orthology (KO) [BR:
ccar00001
]
09120 Genetic Information Processing
09121 Transcription
03040 Spliceosome
122143439
09180 Brite Hierarchies
09182 Protein families: genetic information processing
03041 Spliceosome [BR:
ccar03041
]
122143439
09184 RNA family
03100 Non-coding RNAs [BR:
ccar03100
]
122143439
Spliceosome [BR:
ccar03041
]
Splicing related RNAs
122143439
Non-coding RNAs [BR:
ccar03100
]
Small nuclear RNA
Sm-class snRNA
122143439
BRITE hierarchy
SSDB
Ortholog
Paralog
Gene cluster
GFIT
Other DBs
NCBI-GeneID:
122143439
LinkDB
All DBs
Position
Unknown
NT seq
111 nt
NT seq
+upstream
nt +downstream
nt
agcgcgagtttctcttcattgtcgcataatctttcgacttttactaaagatttcgtgagg
ggaagctttgcgaggacctgtatttttgggggctatgctcacagcagagct
DBGET
integrated database retrieval system