Capra hircus (goat): 104795700 Help Entry 104795700         miRNA     T02910                                  Symbol MIRLET7A Name (RefSeq) chi-let-7a-5p   KO K16980   microRNA let-7 Organism chx  Capra hircus (goat) Pathway chx05206   MicroRNAs in cancer chx05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:chx00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104795700 (MIRLET7A)    05207 Chemical carcinogenesis - receptor activation     104795700 (MIRLET7A)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:chx04147]     104795700 (MIRLET7A)   09184 RNA family    03100 Non-coding RNAs [BR:chx03100]     104795700 (MIRLET7A) Exosome [BR:chx04147]  Exosomal RNA   Exosomal RNA of breast milk    104795700 (MIRLET7A)   Exosomal RNA of saliva    104795700 (MIRLET7A)   Exosomal RNA of ovarian cancer cells    104795700 (MIRLET7A)   Exosomal RNA of renal carcinoma cells    104795700 (MIRLET7A)   Exosomal RNA of other cancer cells    104795700 (MIRLET7A) Non-coding RNAs [BR:chx03100]  Other eukaryotic RNA   Micro RNA    104795700 (MIRLET7A) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104795700 miRBase:  MI0030579 LinkDB All DBs Position 5:115353166..115353271 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tgaggtagtaggttgtatagtt

DBGET integrated database retrieval system