Capra hircus (goat): 104795701 Help Entry 104795701         miRNA     T02910                                  Symbol MIRLET7D Name (RefSeq) chi-let-7d-5p   KO K16980   microRNA let-7 Organism chx  Capra hircus (goat) Pathway chx05206   MicroRNAs in cancer chx05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:chx00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104795701 (MIRLET7D)    05207 Chemical carcinogenesis - receptor activation     104795701 (MIRLET7D)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:chx04147]     104795701 (MIRLET7D)   09184 RNA family    03100 Non-coding RNAs [BR:chx03100]     104795701 (MIRLET7D) Exosome [BR:chx04147]  Exosomal RNA   Exosomal RNA of breast milk    104795701 (MIRLET7D)   Exosomal RNA of saliva    104795701 (MIRLET7D)   Exosomal RNA of ovarian cancer cells    104795701 (MIRLET7D)   Exosomal RNA of renal carcinoma cells    104795701 (MIRLET7D)   Exosomal RNA of other cancer cells    104795701 (MIRLET7D) Non-coding RNAs [BR:chx03100]  Other eukaryotic RNA   Micro RNA    104795701 (MIRLET7D) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104795701 miRBase:  MI0030582 LinkDB All DBs Position 8:85210061..85210165 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt agaggtagtaggttgcatagtt

DBGET integrated database retrieval system