Capra hircus (goat): 104795703 Help Entry 104795703         miRNA     T02910                                  Symbol MIRLET7F Name (RefSeq) chi-let-7f-5p   KO K16980   microRNA let-7 Organism chx  Capra hircus (goat) Pathway chx05206   MicroRNAs in cancer chx05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:chx00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104795703 (MIRLET7F)    05207 Chemical carcinogenesis - receptor activation     104795703 (MIRLET7F)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:chx04147]     104795703 (MIRLET7F)   09184 RNA family    03100 Non-coding RNAs [BR:chx03100]     104795703 (MIRLET7F) Exosome [BR:chx04147]  Exosomal RNA   Exosomal RNA of breast milk    104795703 (MIRLET7F)   Exosomal RNA of saliva    104795703 (MIRLET7F)   Exosomal RNA of ovarian cancer cells    104795703 (MIRLET7F)   Exosomal RNA of renal carcinoma cells    104795703 (MIRLET7F)   Exosomal RNA of other cancer cells    104795703 (MIRLET7F) Non-coding RNAs [BR:chx03100]  Other eukaryotic RNA   Micro RNA    104795703 (MIRLET7F) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104795703 miRBase:  MI0030584 LinkDB All DBs Position 8:85207848..85207957 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tgaggtagtagattgtatagtt

DBGET integrated database retrieval system