Capra hircus (goat): 104795868 Help Entry 104795868         miRNA     T02910                                  Symbol MIR98 Name (RefSeq) chi-miR-98-5p   KO K16980   microRNA let-7 Organism chx  Capra hircus (goat) Pathway chx05206   MicroRNAs in cancer chx05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:chx00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104795868 (MIR98)    05207 Chemical carcinogenesis - receptor activation     104795868 (MIR98)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:chx04147]     104795868 (MIR98)   09184 RNA family    03100 Non-coding RNAs [BR:chx03100]     104795868 (MIR98) Exosome [BR:chx04147]  Exosomal RNA   Exosomal RNA of breast milk    104795868 (MIR98)   Exosomal RNA of saliva    104795868 (MIR98)   Exosomal RNA of ovarian cancer cells    104795868 (MIR98)   Exosomal RNA of renal carcinoma cells    104795868 (MIR98)   Exosomal RNA of other cancer cells    104795868 (MIR98) Non-coding RNAs [BR:chx03100]  Other eukaryotic RNA   Micro RNA    104795868 (MIR98) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104795868 miRBase:  MI0030844 LinkDB All DBs Position X Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tgaggtagtaagttgtattgtt

DBGET integrated database retrieval system