Gallus gallus (chicken): 777837 Help Entry 777837            miRNA     T01006                                  Symbol MIRLET7F1 Name (RefSeq) gga-let-7f-5p   KO K16980   microRNA let-7 Organism gga  Gallus gallus (chicken) Brite KEGG Orthology (KO) [BR:gga00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:gga04147]     777837 (MIRLET7F1)   09184 RNA family    03100 Non-coding RNAs [BR:gga03100]     777837 (MIRLET7F1) Exosome [BR:gga04147]  Exosomal RNA   Exosomal RNA of breast milk    777837 (MIRLET7F1)   Exosomal RNA of saliva    777837 (MIRLET7F1)   Exosomal RNA of ovarian cancer cells    777837 (MIRLET7F1)   Exosomal RNA of renal carcinoma cells    777837 (MIRLET7F1)   Exosomal RNA of other cancer cells    777837 (MIRLET7F1) Non-coding RNAs [BR:gga03100]  Other eukaryotic RNA   Micro RNA    777837 (MIRLET7F1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  777837 CGNC:  59122 Ensembl:  ENSGALG00000018265 miRBase:  MI0001233 LinkDB All DBs Position 12:complement(6489791..6489877) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tgaggtagtagattgtatagtt

DBGET integrated database retrieval system