Homo sapiens (human): 406983 Help Entry 406983            miRNA     T01001                                  Symbol MIR200A, MIRN200A, mir-200a Name (RefSeq) microRNA 200a   KO K17015   microRNA 200a Organism hsa  Homo sapiens (human) Pathway hsa05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:hsa00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     406983 (MIR200A)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:hsa04147]     406983 (MIR200A)   09184 RNA family    03100 Non-coding RNAs [BR:hsa03100]     406983 (MIR200A) Exosome [BR:hsa04147]  Exosomal RNA   Exosomal RNA of ovarian cancer cells    406983 (MIR200A) Non-coding RNAs [BR:hsa03100]  Other eukaryotic RNA   Micro RNA    406983 (MIR200A) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  406983 OMIM:  612090 HGNC:  31578 Ensembl:  ENSG00000207607 miRBase:  MI0000737 LinkDB All DBs Position 1:1167863..1167952 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt catcttaccggacagtgctgga

DBGET integrated database retrieval system