KEGG   Homo sapiens (human): 406999
Entry
406999            miRNA     T01001                                 
Symbol
MIR217, MIRN217, mir-217
Name
(RefSeq) microRNA 217
  KO
K17125  microRNA 217
Organism
hsa  Homo sapiens (human)
Pathway
hsa04936  Alcoholic liver disease
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09167 Endocrine and metabolic disease
   04936 Alcoholic liver disease
    406999 (MIR217)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406999 (MIR217)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406999 (MIR217)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of pancreatic cells
   406999 (MIR217)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406999 (MIR217)
SSDB
Other DBs
NCBI-GeneID: 406999
OMIM: 615096
HGNC: 31594
Ensembl: ENSG00000207548
miRBase: MI0000293
LinkDB
Position
2:complement(55982967..55983076)
NT seq 23 nt   +upstreamnt  +downstreamnt
tactgcatcaggaactgattgga

DBGET integrated database retrieval system