Homo sapiens (human): 407033 Help Entry 407033            miRNA     T01001                                  Symbol MIR30D, MIRN30D, mir-30d Name (RefSeq) microRNA 30d   KO K17110   microRNA 30 Organism hsa  Homo sapiens (human) Pathway hsa05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:hsa00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     407033 (MIR30D)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:hsa04147]     407033 (MIR30D)   09184 RNA family    03100 Non-coding RNAs [BR:hsa03100]     407033 (MIR30D) Exosome [BR:hsa04147]  Exosomal RNA   Exosomal RNA of breast milk    407033 (MIR30D)   Exosomal RNA of hepatic cancer cells    407033 (MIR30D)   Exosomal RNA of lung cancer cells    407033 (MIR30D) Non-coding RNAs [BR:hsa03100]  Other eukaryotic RNA   Micro RNA    407033 (MIR30D) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  407033 OMIM:  619019 HGNC:  31628 Ensembl:  ENSG00000199153 miRBase:  MI0000255 LinkDB All DBs Position 8:complement(134804876..134804945) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tgtaaacatccccgactggaag

DBGET integrated database retrieval system