Homo sapiens (human): 442895 Help Entry 442895            miRNA     T01001                                  Symbol MIR302C, MIRN302C, mir-302c Name (RefSeq) microRNA 302c   KO K17186   microRNA 302c Organism hsa  Homo sapiens (human) Brite KEGG Orthology (KO) [BR:hsa00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:hsa04147]     442895 (MIR302C)   09184 RNA family    03100 Non-coding RNAs [BR:hsa03100]     442895 (MIR302C) Exosome [BR:hsa04147]  Exosomal RNA   Exosomal RNA of lung cancer cells    442895 (MIR302C) Non-coding RNAs [BR:hsa03100]  Other eukaryotic RNA   Micro RNA    442895 (MIR302C) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  442895 OMIM:  614598 HGNC:  31764 Ensembl:  ENSG00000199102 miRBase:  MI0000773 LinkDB All DBs Position 4:complement(112648363..112648430) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tttaacatgggggtacctgctg

DBGET integrated database retrieval system