Homo sapiens (human): 4496 Help Entry 4496              CDS       T01001                                  Symbol MT1H, MT-0, MT-1H, MT-IH, MT1 Name (RefSeq) metallothionein 1H   KO K14739   metallothionein 1/2 Organism hsa  Homo sapiens (human) Pathway hsa04978   Mineral absorption Brite KEGG Orthology (KO) [BR:hsa00001]  09150 Organismal Systems   09154 Digestive system    04978 Mineral absorption     4496 (MT1H)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:hsa03019]     4496 (MT1H)    03029 Mitochondrial biogenesis [BR:hsa03029]     4496 (MT1H) Messenger RNA biogenesis [BR:hsa03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      4496 (MT1H) Mitochondrial biogenesis [BR:hsa03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     4496 (MT1H) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  4496 NCBI-ProteinID:  NP_005942 OMIM:  156354 HGNC:  7400 Ensembl:  ENSG00000205358 UniProt:  P80294 A0A140VJP7 LinkDB All DBs Position 16:56669814..56671129 Genome browser AA seq 61 aa AA seqDB search MDPNCSCEAGGSCACAGSCKCKKCKCTSCKKSCCSCCPLGCAKCAQGCICKGASEKCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggaccccaactgctcctgcgaggctggtggctcctgcgcctgcgccggctcctgcaag tgcaaaaagtgcaaatgcacctcctgcaagaagagctgctgctcctgttgccccctgggc tgtgccaagtgtgcccagggctgcatctgcaaaggggcgtcagagaagtgcagctgctgt gcctga

DBGET integrated database retrieval system