Homo sapiens (human): 574479 Help Entry 574479            miRNA     T01001                                  Symbol MIR517A, MIRN517A, mir-517a Name (RefSeq) microRNA 517a   KO K17173   microRNA 517 Organism hsa  Homo sapiens (human) Brite KEGG Orthology (KO) [BR:hsa00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:hsa04147]     574479 (MIR517A)   09184 RNA family    03100 Non-coding RNAs [BR:hsa03100]     574479 (MIR517A) Exosome [BR:hsa04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    574479 (MIR517A)   Exosomal RNA of other cancer cells    574479 (MIR517A) Non-coding RNAs [BR:hsa03100]  Small non-coding RNA   Micro RNA    574479 (MIR517A) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  574479 OMIM:  620600 HGNC:  32111 Ensembl:  ENSG00000207734 miRBase:  MI0003161 LinkDB All DBs Position 19:53712268..53712354 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt cctctagatggaagcactgtct

DBGET integrated database retrieval system