Homo sapiens (human): 574493 Help Entry 574493            miRNA     T01001                                  Symbol MIR520H, MIRN520H Name (RefSeq) microRNA 520h   KO K17175   microRNA 520 Organism hsa  Homo sapiens (human) Pathway hsa05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:hsa00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     574493 (MIR520H)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:hsa04147]     574493 (MIR520H)   09184 RNA family    03100 Non-coding RNAs [BR:hsa03100]     574493 (MIR520H) Exosome [BR:hsa04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    574493 (MIR520H) Non-coding RNAs [BR:hsa03100]  Other eukaryotic RNA   Micro RNA    574493 (MIR520H) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  574493 OMIM:  614755 HGNC:  32125 Ensembl:  ENSG00000207861 miRBase:  MI0003175 LinkDB All DBs Position 19:53742512..53742599 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt acaaagtgcttccctttagagt

DBGET integrated database retrieval system