KEGG   Homo sapiens (human): 6315
Entry
6315              ncRNA     T01001                                 

Gene name
ATXN8OS, KLHL1AS, NCRNA00003, SCA8
Definition
(RefSeq) ATXN8 opposite strand lncRNA
  KO
K23933  ATXN8 opposite strand lncRNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa05017  Spinocerebellar ataxia
Disease
H00063  Spinocerebellar ataxia (SCA)
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09164 Neurodegenerative disease
   05017 Spinocerebellar ataxia
    6315 (ATXN8OS)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    6315 (ATXN8OS)
Non-coding RNAs [BR:hsa03100]
 Long-non-coding RNA
  6315 (ATXN8OS)
SSDB
Other DBs
NCBI-GeneID: 6315
OMIM: 603680
HGNC: 10561
LinkDB
Position
13q21.33
NT seq 1472 nt   +upstreamnt  +downstreamnt
atccttcacctgttgcctggctagagttgtctggctccactttgagctcttgcagaacca
gccctttttcgtgtggtccaggaaagtccatgcctggcaccacctcctcctctagtgact
ccacgtagaagagagtcctggctggctgctgagtgccctgcccaggagccccttgctgca
gcctcgtggcaactggaagcagggtgccattcagcggattgaaggaagaggaggaagagg
acggggaggacgatgaagaggaagaggaggaaggcttcttccagaaagtgctcacaccgc
ttctctcttggcttttgagcaggcgactctggctgggtccccagtgctcaaagctgccac
tgccgtcctgttgcaggcagcctccccccgccgggccgccggtggaaggagacgggtggc
tgaagagtttccagcggagtcgcagaatgtgcttcacatcgaagtcttttcgcccagagc
ctgacatgctttacgcacagaaggcaaaaggctggcagctcacgcaggattctggaggct
gggaagttcaagaccaatgcacgagaatttggtctaaagagaatcttcttgctctgaaca
cacatagtagaaggcagaagggcaagagagagaacaaagtctgtgtctccacatggcaga
agagcagaggagacagaacctactcctctatggcaaccaccccatcaatgacaaaaatcc
tagaaggatgtatgtataggaagttgaagtgttgagaagagaatggctcagagtcaagcg
ggaacaagattcaaacttcagagagagagggaagaaaaacatttaaatatatctggcata
atccaagactatttacgacaagtgttctgtgtttctaataataaaacagacttcacctcg
gagtacctgcagaactgggaccccaatgaccagggagaatgaagaacaacttgttgaaga
ttgccttttctgactcccagcttccacggagagattaactctgttggctgaagccctatt
cccaattccttggctagaccctgggtccttcatgttagaaaacctggctttactactact
actactactactactactactactgctgctgctgctgctgctgctgctgctgctgctgct
gctgctgcattttttaaaaatatattatcttattttactatttgatgttataattgttat
atatttttccacacttcctcatactgcttatctcttacttaagaatttatgaataaagaa
ttgatttttcaatacatccttccaaaaattatctgatgttgagttagttgctctctcttg
tgcattctcagtcctcacaagcctttctcaaacacaatgtttatcaaagaaaattgtagc
aaccaatatacttagtggaatttctcacagagtttgagtgtaggaaacagtattcactgt
atattagtcattttgctcccaatagaaggtgc

DBGET integrated database retrieval system