Lycorma delicatula (spotted lanternfly): 142318594
Help
Entry
142318594 ncRNA
T11193
Name
(RefSeq) U5 spliceosomal RNA
KO
K14279
U5 spliceosomal RNA
Organism
lda Lycorma delicatula (spotted lanternfly)
Pathway
lda03040
Spliceosome
Brite
KEGG Orthology (KO) [BR:
lda00001
]
09120 Genetic Information Processing
09121 Transcription
03040 Spliceosome
142318594
09180 Brite Hierarchies
09182 Protein families: genetic information processing
03041 Spliceosome [BR:
lda03041
]
142318594
09184 RNA family
03100 Non-coding RNAs [BR:
lda03100
]
142318594
Spliceosome [BR:
lda03041
]
Splicing related RNAs
142318594
Non-coding RNAs [BR:
lda03100
]
Small nuclear RNA
Sm-class snRNA
142318594
BRITE hierarchy
SSDB
Ortholog
Paralog
Gene cluster
GFIT
Other DBs
NCBI-GeneID:
142318594
LinkDB
All DBs
Position
1:complement(384455283..384455399)
Genome browser
NT seq
117 nt
NT seq
+upstream
nt +downstream
nt
atactctggtctcttttcatttcgtataaatctttcgccttttactaaagatttccgtgg
aaagaggcaaatgatgagtctatattaattttttgtcagtgcctgccccaaggggcg
DBGET
integrated database retrieval system