Macaca mulatta (rhesus monkey): 100315173 Help Entry 100315173         miRNA     T01028                                  Symbol MIRLET7F-1 Name (RefSeq) mml-let-7f-5p   KO K16980   microRNA let-7 Organism mcc  Macaca mulatta (rhesus monkey) Pathway mcc05206   MicroRNAs in cancer mcc05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:mcc00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100315173 (MIRLET7F-1)    05207 Chemical carcinogenesis - receptor activation     100315173 (MIRLET7F-1)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:mcc04147]     100315173 (MIRLET7F-1)   09184 RNA family    03100 Non-coding RNAs [BR:mcc03100]     100315173 (MIRLET7F-1) Exosome [BR:mcc04147]  Exosomal RNA   Exosomal RNA of breast milk    100315173 (MIRLET7F-1)   Exosomal RNA of saliva    100315173 (MIRLET7F-1)   Exosomal RNA of ovarian cancer cells    100315173 (MIRLET7F-1)   Exosomal RNA of renal carcinoma cells    100315173 (MIRLET7F-1)   Exosomal RNA of other cancer cells    100315173 (MIRLET7F-1) Non-coding RNAs [BR:mcc03100]  Other eukaryotic RNA   Micro RNA    100315173 (MIRLET7F-1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315173 Ensembl:  ENSMMUG00000027104 miRBase:  MI0007577 LinkDB All DBs Position 15:109111553..109111639 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tgaggtagtagattgtatagtt

DBGET integrated database retrieval system