Macaca mulatta (rhesus monkey): 100315389 Help Entry 100315389         miRNA     T01028                                  Symbol MIRLET7B Name (RefSeq) mml-let-7b-5p   KO K16980   microRNA let-7 Organism mcc  Macaca mulatta (rhesus monkey) Pathway mcc05206   MicroRNAs in cancer mcc05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:mcc00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100315389 (MIRLET7B)    05207 Chemical carcinogenesis - receptor activation     100315389 (MIRLET7B)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:mcc04147]     100315389 (MIRLET7B)   09184 RNA family    03100 Non-coding RNAs [BR:mcc03100]     100315389 (MIRLET7B) Exosome [BR:mcc04147]  Exosomal RNA   Exosomal RNA of breast milk    100315389 (MIRLET7B)   Exosomal RNA of saliva    100315389 (MIRLET7B)   Exosomal RNA of ovarian cancer cells    100315389 (MIRLET7B)   Exosomal RNA of renal carcinoma cells    100315389 (MIRLET7B)   Exosomal RNA of other cancer cells    100315389 (MIRLET7B) Non-coding RNAs [BR:mcc03100]  Small non-coding RNA   Micro RNA    100315389 (MIRLET7B) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315389 Ensembl:  ENSMMUG00000033257 miRBase:  MI0007573 LinkDB All DBs Position 10:complement(5393685..5393767) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tgaggtagtaggttgtgtggtt

DBGET integrated database retrieval system