Macaca mulatta (rhesus monkey): 100315443 Help Entry 100315443         miRNA     T01028                                  Symbol MIRLET7I Name (RefSeq) mml-let-7i-5p   KO K16980   microRNA let-7 Organism mcc  Macaca mulatta (rhesus monkey) Pathway mcc05206   MicroRNAs in cancer mcc05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:mcc00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100315443 (MIRLET7I)    05207 Chemical carcinogenesis - receptor activation     100315443 (MIRLET7I)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:mcc04147]     100315443 (MIRLET7I)   09184 RNA family    03100 Non-coding RNAs [BR:mcc03100]     100315443 (MIRLET7I) Exosome [BR:mcc04147]  Exosomal RNA   Exosomal RNA of breast milk    100315443 (MIRLET7I)   Exosomal RNA of saliva    100315443 (MIRLET7I)   Exosomal RNA of ovarian cancer cells    100315443 (MIRLET7I)   Exosomal RNA of renal carcinoma cells    100315443 (MIRLET7I)   Exosomal RNA of other cancer cells    100315443 (MIRLET7I) Non-coding RNAs [BR:mcc03100]  Small non-coding RNA   Micro RNA    100315443 (MIRLET7I) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315443 Ensembl:  ENSMMUG00000026990 miRBase:  MI0007580 LinkDB All DBs Position 11:62316677..62316761 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tgaggtagtagtttgtgctgtt

DBGET integrated database retrieval system