Nothoprocta perdicaria (Chilean tinamou): 112943907
Help
Entry
112943907 ncRNA
T07556
Name
(RefSeq) U5 spliceosomal RNA
KO
K14279
U5 spliceosomal RNA
Organism
npd
Nothoprocta perdicaria (Chilean tinamou)
Pathway
npd03040
Spliceosome
Brite
KEGG Orthology (KO) [BR:
npd00001
]
09120 Genetic Information Processing
09121 Transcription
03040 Spliceosome
112943907
09180 Brite Hierarchies
09182 Protein families: genetic information processing
03041 Spliceosome [BR:
npd03041
]
112943907
09184 RNA family
03100 Non-coding RNAs [BR:
npd03100
]
112943907
Spliceosome [BR:
npd03041
]
Splicing related RNAs
112943907
Non-coding RNAs [BR:
npd03100
]
Small nuclear RNA
Sm-class snRNA
112943907
BRITE hierarchy
SSDB
Ortholog
Paralog
GFIT
Other DBs
NCBI-GeneID:
112943907
LinkDB
All DBs
Position
Unknown
NT seq
123 nt
NT seq
+upstream
nt +downstream
nt
gtactctaccttctctttatctcatacaaatttttcgccttttaccaaagatttcagtag
agaaggccctttctcactatcaacccaagcaattttaacctttactttggctacagcaga
aag
DBGET
integrated database retrieval system