Nematostella vectensis (starlet sea anemone): 116618263
Help
Entry
116618263 ncRNA
T01037
Name
(RefSeq) U5 spliceosomal RNA
KO
K14279
U5 spliceosomal RNA
Organism
nve
Nematostella vectensis (starlet sea anemone)
Pathway
nve03040
Spliceosome
Brite
KEGG Orthology (KO) [BR:
nve00001
]
09120 Genetic Information Processing
09121 Transcription
03040 Spliceosome
116618263
09180 Brite Hierarchies
09182 Protein families: genetic information processing
03041 Spliceosome [BR:
nve03041
]
116618263
09184 RNA family
03100 Non-coding RNAs [BR:
nve03100
]
116618263
Spliceosome [BR:
nve03041
]
Splicing related RNAs
116618263
Non-coding RNAs [BR:
nve03100
]
Small nuclear RNA
Sm-class snRNA
116618263
BRITE hierarchy
SSDB
Ortholog
Paralog
GFIT
Other DBs
NCBI-GeneID:
116618263
LinkDB
All DBs
Position
Unknown
NT seq
122 nt
NT seq
+upstream
nt +downstream
nt
gcactctggttttccttcatatcgagtaaatctttcgccttttactaaagatttccgtgg
aggagagcactgaaatgagtatatcactcaatttttggtttgccctgcatttttgcgggg
ct
DBGET
integrated database retrieval system