Olsenella sp. oral taxon 807: ADJ70_11695 Help Entry ADJ70_11695       CDS       T04016                                  Name (GenBank) cytochrome C552   KO K14188   D-alanine--poly(phosphoribitol) ligase subunit 2 [EC:6.1.1.13] Organism olo  Olsenella sp. oral taxon 807 Pathway olo00470   D-Amino acid metabolism olo00552   Teichoic acid biosynthesis olo01100   Metabolic pathways olo01503   Cationic antimicrobial peptide (CAMP) resistance olo02020   Two-component system Brite KEGG Orthology (KO) [BR:olo00001]  09100 Metabolism   09106 Metabolism of other amino acids    00470 D-Amino acid metabolism     ADJ70_11695   09107 Glycan biosynthesis and metabolism    00552 Teichoic acid biosynthesis     ADJ70_11695  09130 Environmental Information Processing   09132 Signal transduction    02020 Two-component system     ADJ70_11695  09160 Human Diseases   09175 Drug resistance: antimicrobial    01503 Cationic antimicrobial peptide (CAMP) resistance     ADJ70_11695  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    01504 Antimicrobial resistance genes [BR:olo01504]     ADJ70_11695 Enzymes [BR:olo01000]  6. Ligases   6.1  Forming carbon-oxygen bonds    6.1.1  Ligases forming aminoacyl-tRNA and related compounds     6.1.1.13  D-alanine---poly(phosphoribitol) ligase      ADJ70_11695 Antimicrobial resistance genes [BR:olo01504]  Gene sets   CAMP resistance modules    Cationic antimicrobial peptide (CAMP) resistance, dltABCD operon [MD:M00725]     ADJ70_11695 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 Motif Other DBs NCBI-ProteinID:  AKT49459 UniProt:  A0A0K1F4W4 LinkDB All DBs Position 1088244..1088501 Genome browser AA seq 85 aa AA seqDB search MGEKISEVELERRMLDLMEEVCEDEAVRDHRDEDLFELGLLDSMAAVELLVGIEEEFGVS IAPTELPRDQMNTVNKIIAQVASRL NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atgggtgagaagatatccgaggtcgagctggaacgtcgcatgcttgacctcatggaggag gtctgcgaggacgaggccgtacgcgaccatcgcgacgaggacctctttgagctgggactg ctcgattccatggccgccgtggagctcttggtggggatagaggaggagttcggcgtctcc atagcgccaacggagcttccccgtgatcagatgaatacggtcaacaagatcatcgcccag gtggcgagcaggctgtag

DBGET integrated database retrieval system