KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131343
Entry
3131343           tRNA      T01015                                 
Symbol
OrsajCt125
Name
(RefSeq) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131343 (OrsajCt125)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131343 (OrsajCt125)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131343 (OrsajCt125)
SSDB
Other DBs
NCBI-GeneID: 3131343
LinkDB
Position
Pltd:12331..12401
NT seq 71 nt   +upstreamnt  +downstreamnt
gcgagcgtagttcaatggtaaaacatctccttgccaaggagaagatacgggttcgattcc
cgccgctcgcc

DBGET integrated database retrieval system