KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131349
Entry
3131349           tRNA      T01015                                 
Symbol
OrsajCt134
Name
(RefSeq) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131349 (OrsajCt134)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131349 (OrsajCt134)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131349 (OrsajCt134)
SSDB
Other DBs
NCBI-GeneID: 3131349
LinkDB
Position
Pltd:16231..16304
NT seq 74 nt   +upstreamnt  +downstreamnt
gggattgtagttcaattggtcagagcaccgccctgtcaaggcggaagctgcgggttcgag
ccccgtcagtcccg

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450190
Entry
6450190           tRNA      T01015                                 
Symbol
trnD, OrsajM_t11
Name
(RefSeq) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450190 (trnD)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450190 (trnD)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450190 (trnD)
SSDB
Other DBs
NCBI-GeneID: 6450190
LinkDB
Position
MT:64882..64955
NT seq 74 nt   +upstreamnt  +downstreamnt
ggggaaatagctcagttggttagagtgctggtctgtcacgccagaagtcgcgggttcgaa
ccccgttttccccg

DBGET integrated database retrieval system