KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131380
Entry
3131380           rRNA      T01015                                 
Symbol
OrsajCr120
Name
(RefSeq) 16S ribosomal RNA
  KO
K01979  small subunit 18S ribosomal RNA
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa03008  Ribosome biogenesis in eukaryotes
osa03010  Ribosome
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    3131380 (OrsajCr120)
   03008 Ribosome biogenesis in eukaryotes
    3131380 (OrsajCr120)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:osa03011]
    3131380 (OrsajCr120)
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131380 (OrsajCr120)
Ribosome [BR:osa03011]
 Ribosomal RNAs
  Eukaryotes
   3131380 (OrsajCr120)
Non-coding RNAs [BR:osa03100]
 Ribosomal RNA
  Eukaryotic rRNA
   3131380 (OrsajCr120)
SSDB
Other DBs
NCBI-GeneID: 3131380
LinkDB
Position
Pltd:complement(122329..123819)
NT seq 1491 nt   +upstreamnt  +downstreamnt
tctcatggagagttcgatcctggctcaggatgaacgctggcggcatgcttaacacatgca
agtcgaacgggaagtggtgtttccagtggcgaacgggtgagtaacgcgtaagaacctgcc
cttgggaggggaacaacaactggaaacggttgctaataccccgtaggctgaggagcaaaa
ggagaaatccgcccaaggaggggctcgcgtctgattagctagttggtgaggcaatagctt
accaaggcgatgatcagtagctggtccgagaggatgatcagccacactgggactgagaca
cggcccagactcctacgggaggcagcagtggggaattttccgcaatgggcgaaagcctga
cggagcaatgccgcgtggaggtggaaggcccacgggtcgtcaacttcttttctcggagaa
gaaacaatgacggtatctgaggaataagcatcggctaactctgtgccagcagccgcggta
agacagaggatgcaagcgttatccggaatgattgggcgtaaagcgtctgtaggtggcttt
tcaagtccgccgtcaaatcccagggctcaaccctggacaggcggtggaaactaccaagct
ggagtacggtaggggcagagggaatttccggtggagcggtgaaatgcattgagatcggaa
agaacaccaacggcgaaagcactctgctgggccgacactgacactgagagacgaaagcta
ggggagcaaatgggattagagaccccagtagtcctagccgtaaacgatggatactaggtg
ctgtgcgactcgacccgtgcagtgctgtagctaacgcgttaagtatcccgcctggggagt
acgttcgcaagaatgaaactcaaaggaattgacgggggcccgcacaagcggtggagcatg
tggtttaattcgatgcaaagcgaagaaccttaccagggcttgacatgccgcgaatcctct
tgaaagagaggggtgccctcgggaacgcggacacaggtggtgcatggctgtcgtcagctc
gtgccgtaaggtgttgggttaagtctcgcaacgagcgcaaccctcgtgtttagttgccac
tatgagtttggaaccctgaacagaccgccggtgttaagccggaggaaggagaggatgagg
ccaagtcatcatgccccttatgccctgggcgacacacgtgctacaatgggcgggacaaag
ggtcgcgatctcgcgagggtgagctaactccaaaaacccgtcctcagttcggattgcagg
ctgcaactcgcctgcatgaagcaggaatcgctagtaatcgccggtcagccatacggcggt
gaatccgttcccgggccttgtacacaccgcccgtcacactataggagctggccatgtttg
aagtcattacccttaaccgtaaggagggggatgcctaaggctaggcttgcgactggagtg
aagtcgtaacaaggtagccgtactggaaggtgcggctggatcacctccttt

DBGET integrated database retrieval system