Penaeus chinensis (fleshy prawn): 125030148
Help
Entry
125030148 ncRNA
T08118
Name
(RefSeq) U5 spliceosomal RNA
KO
K14279
U5 spliceosomal RNA
Organism
pchn
Penaeus chinensis (fleshy prawn)
Pathway
pchn03040
Spliceosome
Brite
KEGG Orthology (KO) [BR:
pchn00001
]
09120 Genetic Information Processing
09121 Transcription
03040 Spliceosome
125030148
09180 Brite Hierarchies
09182 Protein families: genetic information processing
03041 Spliceosome [BR:
pchn03041
]
125030148
09184 RNA family
03100 Non-coding RNAs [BR:
pchn03100
]
125030148
Spliceosome [BR:
pchn03041
]
Splicing related RNAs
125030148
Non-coding RNAs [BR:
pchn03100
]
Small nuclear RNA
Sm-class snRNA
125030148
BRITE hierarchy
SSDB
Ortholog
Paralog
Gene cluster
GFIT
Other DBs
NCBI-GeneID:
125030148
LinkDB
All DBs
Position
10:2200557..2200674
Genome browser
NT seq
118 nt
NT seq
+upstream
nt +downstream
nt
taactctggtttcccttcaaaacgcataaatctttcgccttttactaaagatttccgtgg
aggggaacaactcaatgagtcttactcaattttttctatagcccacttctgtgggttc
DBGET
integrated database retrieval system