Phyllostomus discolor (pale spear-nosed bat): 118499353
Help
Entry
118499353 CDS
T07739
Name
(RefSeq) thymosin beta-4-like
KO
K05764
thymosin, beta 4
Organism
pdic
Phyllostomus discolor (pale spear-nosed bat)
Pathway
pdic04810
Regulation of actin cytoskeleton
Brite
KEGG Orthology (KO) [BR:
pdic00001
]
09140 Cellular Processes
09142 Cell motility
04810 Regulation of actin cytoskeleton
118499353
09180 Brite Hierarchies
09183 Protein families: signaling and cellular processes
04812 Cytoskeleton proteins [BR:
pdic04812
]
118499353
Cytoskeleton proteins [BR:
pdic04812
]
Eukaryotic cytoskeleton proteins
Actin filaments / Microfilaments
Actin-binding proteins
Thymosin
118499353
BRITE hierarchy
SSDB
Ortholog
Paralog
Gene cluster
GFIT
Motif
Pfam:
Thymosin
Motif
Other DBs
NCBI-GeneID:
118499353
NCBI-ProteinID:
XP_035875947
UniProt:
A0A7E6D9Q1
LinkDB
All DBs
Position
3:complement(178845408..178846310)
Genome browser
AA seq
43 aa
AA seq
DB search
MSDKPDMAEIEELGKSKLKTETQEKNPLLSKESAEQEKQAGKS
NT seq
132 nt
NT seq
+upstream
nt +downstream
nt
atgtctgacaaacccgatatggctgagattgaggaacttggtaagtcaaaactgaagaca
gaaacacaagagaaaaatccactgctttcaaaagaaagtgctgaacaggagaagcaagcc
ggcaaatcataa
DBGET
integrated database retrieval system