KEGG   Pleuronectes platessa (European plaice): 128427816
Entry
128427816         ncRNA     T09923                                 
Name
(RefSeq) U5 spliceosomal RNA
  KO
K14279  U5 spliceosomal RNA
Organism
pplt  Pleuronectes platessa (European plaice)
Pathway
pplt03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:pplt00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    128427816
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:pplt03041]
    128427816
  09184 RNA family
   03100 Non-coding RNAs [BR:pplt03100]
    128427816
Spliceosome [BR:pplt03041]
 Splicing related RNAs
  128427816
Non-coding RNAs [BR:pplt03100]
 Small nuclear RNA
  Sm-class snRNA
   128427816
SSDB
Other DBs
NCBI-GeneID: 128427816
LinkDB
Position
21:complement(19377350..19377466)
NT seq 117 nt   +upstreamnt  +downstreamnt
tgactctggtttctcttcataacgcacaagtctttcgccttttactaaagacttccgtgg
agaggaacaaacatgagttgaatctaattttggcaggctttgctttatggctgagcc

DBGET integrated database retrieval system