Pan troglodytes (chimpanzee): 100316108 Help Entry 100316108         miRNA     T01005                                  Symbol MIR16-2 Name (RefSeq) ptr-miR-16   KO K16988   microRNA 16 Organism ptr  Pan troglodytes (chimpanzee) Pathway ptr05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:ptr00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100316108 (MIR16-2)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ptr04147]     100316108 (MIR16-2)   09184 RNA family    03100 Non-coding RNAs [BR:ptr03100]     100316108 (MIR16-2) Exosome [BR:ptr04147]  Exosomal RNA   Exosomal RNA of breast milk    100316108 (MIR16-2)   Exosomal RNA of hepatic cancer cells    100316108 (MIR16-2)   Exosomal RNA of lung cancer cells    100316108 (MIR16-2)   Exosomal RNA of other cancer cells    100316108 (MIR16-2) Non-coding RNAs [BR:ptr03100]  Small non-coding RNA   Micro RNA    100316108 (MIR16-2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100316108 miRBase:  MI0008555 LinkDB All DBs Position 2:163583047..163583126 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tagcagcacgtaaatattggcg

DBGET integrated database retrieval system