Pan troglodytes (chimpanzee): 100316151 Help Entry 100316151         miRNA     T01005                                  Symbol MIR367 Name (RefSeq) ptr-miR-367   KO K17169   microRNA 367 Organism ptr  Pan troglodytes (chimpanzee) Brite KEGG Orthology (KO) [BR:ptr00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ptr04147]     100316151 (MIR367)   09184 RNA family    03100 Non-coding RNAs [BR:ptr03100]     100316151 (MIR367) Exosome [BR:ptr04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    100316151 (MIR367) Non-coding RNAs [BR:ptr03100]  Other eukaryotic RNA   Micro RNA    100316151 (MIR367) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100316151 miRBase:  MI0008638 LinkDB All DBs Position 3:complement(114112124..114112190) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt aattgcactttagcaatggtga

DBGET integrated database retrieval system