Pan troglodytes (chimpanzee): 100316190 Help Entry 100316190         miRNA     T01005                                  Symbol MIR517B-1 Name (RefSeq) ptr-miR-517b   KO K17173   microRNA 517 Organism ptr  Pan troglodytes (chimpanzee) Brite KEGG Orthology (KO) [BR:ptr00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ptr04147]     100316190 (MIR517B-1)   09184 RNA family    03100 Non-coding RNAs [BR:ptr03100]     100316190 (MIR517B-1) Exosome [BR:ptr04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    100316190 (MIR517B-1)   Exosomal RNA of other cancer cells    100316190 (MIR517B-1) Non-coding RNAs [BR:ptr03100]  Other eukaryotic RNA   Micro RNA    100316190 (MIR517B-1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100316190 miRBase:  MI0008710 LinkDB All DBs Position 20:56549311..56549377 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt cctctagatggaagcactgtct

DBGET integrated database retrieval system