Pan troglodytes (chimpanzee): 100316249 Help Entry 100316249         miRNA     T01005                                  Symbol MIR621 Name (RefSeq) ptr-miR-621   KO K17139   microRNA 621 Organism ptr  Pan troglodytes (chimpanzee) Brite KEGG Orthology (KO) [BR:ptr00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ptr04147]     100316249 (MIR621)   09184 RNA family    03100 Non-coding RNAs [BR:ptr03100]     100316249 (MIR621) Exosome [BR:ptr04147]  Exosomal RNA   Exosomal RNA of saliva    100316249 (MIR621) Non-coding RNAs [BR:ptr03100]  Other eukaryotic RNA   Micro RNA    100316249 (MIR621) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100316249 miRBase:  MI0008819 LinkDB All DBs Position 14:39908786..39908880 Genome browser NT seq 21 nt NT seq  +upstreamnt  +downstreamnt ggctagcaacagcgcttacct

DBGET integrated database retrieval system