Pan troglodytes (chimpanzee): 100316291 Help Entry 100316291         miRNA     T01005                                  Symbol MIR373 Name (RefSeq) ptr-miR-373   KO K17000   microRNA 373 Organism ptr  Pan troglodytes (chimpanzee) Pathway ptr05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:ptr00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100316291 (MIR373)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ptr04147]     100316291 (MIR373)   09184 RNA family    03100 Non-coding RNAs [BR:ptr03100]     100316291 (MIR373) Exosome [BR:ptr04147]  Exosomal RNA   Exosomal RNA of ovarian cancer cells    100316291 (MIR373)   Exosomal RNA of hepatic cancer cells    100316291 (MIR373) Non-coding RNAs [BR:ptr03100]  Small non-coding RNA   Micro RNA    100316291 (MIR373) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100316291 miRBase:  MI0012564 LinkDB All DBs Position 20:56615938..56616006 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt actcaaaatgggggcgctttcc

DBGET integrated database retrieval system