Pan troglodytes (chimpanzee): 101954248 Help Entry 101954248         miRNA     T01005                                  Symbol MIR92B Name (RefSeq) ptr-miR-92b   KO K17008   microRNA 92 Organism ptr  Pan troglodytes (chimpanzee) Pathway ptr05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:ptr00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     101954248 (MIR92B)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ptr04147]     101954248 (MIR92B)   09184 RNA family    03100 Non-coding RNAs [BR:ptr03100]     101954248 (MIR92B) Exosome [BR:ptr04147]  Exosomal RNA   Exosomal RNA of breast milk    101954248 (MIR92B)   Exosomal RNA of colorectal cancer cells    101954248 (MIR92B)   Exosomal RNA of renal carcinoma cells    101954248 (MIR92B)   Exosomal RNA of other cancer cells    101954248 (MIR92B) Non-coding RNAs [BR:ptr03100]  Other eukaryotic RNA   Micro RNA    101954248 (MIR92B) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  101954248 miRBase:  MI0020575 LinkDB All DBs Position 1:complement(94000411..94000519) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tattgcactcgtcccggcctcc

DBGET integrated database retrieval system